|
Genecopoeia
single guide rnas sgrnas expression clones targeting mfn2 gene Single Guide Rnas Sgrnas Expression Clones Targeting Mfn2 Gene, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/sgRNA%2FCas9+all-in-one+expression+clones+targeting+MFN2/pmc09456763__pnas__2206708119__sapp-233-0-11 Average 94 stars, based on 1 article reviews
single guide rnas sgrnas expression clones targeting mfn2 gene - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Addgene inc
single guide rna sgrna expression Single Guide Rna Sgrna Expression, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/Cas9+sgRNA+vector+(Plasmid+%2368463)/bio_rxiv__2024__03__12__584646-279-8-27 Average 97 stars, based on 1 article reviews
single guide rna sgrna expression - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |
|
Addgene inc
guide rna sgrna Guide Rna Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/pSAG1%3A%3ACAS9-U6%3A%3AsgUPRT+(Plasmid+%2354467)/pmc06355381-56-6-13 Average 93 stars, based on 1 article reviews
guide rna sgrna - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
ToolGen Incorporated
single guide rna for gfp with u6 promoter (toolgen) ![]() Single Guide Rna For Gfp With U6 Promoter (Toolgen), supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/cas9+protein/pmc04914850-239-12-26 Average 90 stars, based on 1 article reviews
single guide rna for gfp with u6 promoter (toolgen) - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
crispr/cas9 single guide sequences ![]() Crispr/Cas9 Single Guide Sequences, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/lentiviral+vectors/pmc08245960-167-1-19 Average 90 stars, based on 1 article reviews
crispr/cas9 single guide sequences - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Addgene inc
single guide rna target sequence gatgtaattaccacatacga ![]() Single Guide Rna Target Sequence Gatgtaattaccacatacga, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pmc07443509-438-1-10 Average 95 stars, based on 1 article reviews
single guide rna target sequence gatgtaattaccacatacga - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Addgene inc
crispr cas9 single guide rnas sgrnas ![]() Crispr Cas9 Single Guide Rnas Sgrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/CRISPR-SP-Cas9+reporter+(Plasmid+%2362733)/pmc09512670__mmc2-640-1-28 Average 96 stars, based on 1 article reviews
crispr cas9 single guide rnas sgrnas - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Addgene inc
cas9 plasmids pss8 ![]() Cas9 Plasmids Pss8, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/pSS8+(Plasmid+%23134473)/bio_rxiv__656512-264-41-58 Average 91 stars, based on 1 article reviews
cas9 plasmids pss8 - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
cd22 crispr cas9 ko plasmid ![]() Cd22 Crispr Cas9 Ko Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/CAS+CRISPR%2FCas9+KO+Plasmid/pmc09780083-152-0-17 Average 93 stars, based on 1 article reviews
cd22 crispr cas9 ko plasmid - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
single guide rnas sgrna ![]() Single Guide Rnas Sgrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/GAL3ST1+CRISPR%2FCas9+KO+Plasmid/pm39000386-328-16-24 Average 92 stars, based on 1 article reviews
single guide rnas sgrna - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Addgene inc
guide rna sgrna plv hip cas9 bsd ![]() Guide Rna Sgrna Plv Hip Cas9 Bsd, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/T4+Lysozyme+S44E+WT*+(Plasmid+%2318323)/pmc09586874-290-22-28 Average 93 stars, based on 1 article reviews
guide rna sgrna plv hip cas9 bsd - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
cas9 single guide rna sgrna expression vector ![]() Cas9 Single Guide Rna Sgrna Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pmc07381364-120-18-25 Average 96 stars, based on 1 article reviews
cas9 single guide rna sgrna expression vector - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Scientific Reports
Article Title: Efficient generation of transgenic cattle using the DNA transposon and their analysis by next-generation sequencing
doi: 10.1038/srep27185
Figure Lengend Snippet: ( a ) After 45 days of embryo transfer, pregnancy was confirmed by ultrasonography. ( b ) The calf was delivered without assistant. ( c ) When ultraviolet light was exposed to nose of tg cattle, GFP expression was strongly observed. And the tg cattle grew up to 12 months old without any healthy issue ( d ). To determine GFP or RFP expression in a piece of tissue or primary skin cells via recombination, the tissue and cells were cultured and transfected with Dre recombinase mRNA by nucleofection (( e ) a piece of tissue from tg cattle-brightness, ( e` ) before Dre recombinase transfection (GFP), ( e`` ) after Dre recombinase transfection (RFP)). The primary skin cells from the tg cattle were isolated, cultured and transfected with Dre recombinase mRNA. Before transfection, only GFP expression was observed, RFP expression were observed via GFP gene excision by recombination (( f – f`` ) before transfection brightness, fluorescence, and merged, respectively; ( g – g`` ) after transfection brightness, fluorescence, and merged, respectively). The transgene integration and recombination were confirmed by genomic DNA PCR (( h ) 1: Molecular maker, 2: Wild type cattle, 3: Blood from tg cattle, 4: Positive control (DNAs), 5: Negative control) and RT-PCR (( i ) 1: Wild type cattle, 2: cDNA from tg cattle, 3: Negative control). After Dre recombinase transfection, GFP excision was confirmed by genomic DNA PCR (( j ) 1: Molecular marker, 2: Before transfection, 3: After transfection, 4: Negative control). Gel image was cropped and original image was seen in .
Article Snippet: As briefly, primary cells from a transgenic cattle (SNU-PB-2) were transfected with
Techniques: Expressing, Cell Culture, Transfection, Isolation, Fluorescence, Positive Control, Negative Control, Reverse Transcription Polymerase Chain Reaction, Marker
Journal: Scientific Reports
Article Title: Efficient generation of transgenic cattle using the DNA transposon and their analysis by next-generation sequencing
doi: 10.1038/srep27185
Figure Lengend Snippet: ( a ) After 45 days of embryo transfer, pregnancy was confirmed by ultrasonography. ( b ) The calf was delivered without any assistance and grew up to 2 months. Analyzing the calf without ultraviolet light, GFP expression was observed in the eyes ( c ) and nose ( d ). The tg cattle have been grown to 5 months old without any health issue ( e ). When ultraviolet light was exposed to the head, GFP expression was strongly observed ( f ). To know GFP in skin cells, the primary skin cells from the tg cattle were isolated and cultured. In over 99% of cells, GFP expression were observed (( g ) brightness; ( g` ) fluorescence). The transgene integration was confirmed by genomic DNA PCR (( h ) 1: Molecular maker, 2: Wild type cattle, 3: Blood from tg cattle, 4: Positive control (DNAs), 5: Negative control) and RT-PCR using primary cells (( i ) 1: cDNA from Wild type cattle, 2: cDNA from tg cattle, 3: Negative control). Gel image was cropped and original image was seen in .
Article Snippet: As briefly, primary cells from a transgenic cattle (SNU-PB-2) were transfected with
Techniques: Expressing, Isolation, Cell Culture, Fluorescence, Positive Control, Negative Control, Reverse Transcription Polymerase Chain Reaction
Journal: bioRxiv
Article Title: Epidermal Growth Factor signaling acts directly and through a sedation neuron to depolarizes a sleep-active neuron following cellular stress
doi: 10.1101/656512
Figure Lengend Snippet: (A-D) RIS-specific knockdown of let-23 reveals a role for EGFR in RIS following cellular stress, in addition to the known role of EGFR in ALA. The heat shock (37°C) is indicated in orange. N indicates number of worms; three biological replicates were performed for each genotype. (A) is the same data as in . (B-C) behavior of the parental strains following a heat shock. (B) The conditional allele of let-23 , FRT::let-23::FRT::GFP , was created using CRISPR/Cas9. (C) The recombinase (FLPase) was expressed in GABAergic neurons, unc-47p::FLP D5 , which include RIS, but no expression was detectable in ALA with this promoter (data not shown). (D) Worms with a conditional knockdown of let-23 in RIS, unc-47p::FLP D5; FRT::let-23::FRT::GFP, displayed reduced quiescence. (E-F) Quantification of locomotion quiescence during and after the heat shock in the conditional strain and in the parental controls. *** denotes statistical significance with p < 0.001, Wilcoxon signed-rank test.
Article Snippet: : To insert the second frt site 2 kb upstream of frt::gfp and 5’to the protein kinase domain in the let-23 locus, the repair oligonucleotide OSS99 was injected into zh130 at a concentration of 500nM, the two single guide with integrated
Techniques: CRISPR, Expressing