plasmid encoding an single-guide rna targeting hla-e and cas9 with puromycin resistance Search Results


94
Genecopoeia single guide rnas sgrnas expression clones targeting mfn2 gene
Single Guide Rnas Sgrnas Expression Clones Targeting Mfn2 Gene, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/sgRNA%2FCas9+all-in-one+expression+clones+targeting+MFN2/pmc09456763__pnas__2206708119__sapp-233-0-11
Average 94 stars, based on 1 article reviews
single guide rnas sgrnas expression clones targeting mfn2 gene - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

97
Addgene inc single guide rna sgrna expression
Single Guide Rna Sgrna Expression, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/Cas9+sgRNA+vector+(Plasmid+%2368463)/bio_rxiv__2024__03__12__584646-279-8-27
Average 97 stars, based on 1 article reviews
single guide rna sgrna expression - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

93
Addgene inc guide rna sgrna
Guide Rna Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/pSAG1%3A%3ACAS9-U6%3A%3AsgUPRT+(Plasmid+%2354467)/pmc06355381-56-6-13
Average 93 stars, based on 1 article reviews
guide rna sgrna - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
ToolGen Incorporated single guide rna for gfp with u6 promoter (toolgen)
( a ) After 45 days of embryo transfer, pregnancy was confirmed by ultrasonography. ( b ) The calf was delivered without assistant. ( c ) When ultraviolet light was exposed to nose of tg cattle, GFP expression was strongly observed. And the tg cattle grew up to 12 months old without any healthy issue ( d ). To determine GFP or RFP expression in a piece of tissue or primary skin cells via recombination, the tissue and cells were cultured <t>and</t> <t>transfected</t> with Dre recombinase mRNA by nucleofection (( e ) a piece of tissue from tg cattle-brightness, ( e` ) before Dre recombinase transfection (GFP), ( e`` ) after Dre recombinase transfection (RFP)). The primary skin cells from the tg cattle were isolated, cultured and transfected with Dre recombinase mRNA. Before transfection, only GFP expression was observed, RFP expression were observed via GFP gene excision by recombination (( f – f`` ) before transfection brightness, fluorescence, and merged, respectively; ( g – g`` ) after transfection brightness, fluorescence, and merged, respectively). The transgene integration and recombination were confirmed by genomic DNA PCR (( h ) 1: Molecular maker, 2: Wild type cattle, 3: Blood from tg cattle, 4: Positive control <t>(DNAs),</t> 5: Negative control) and RT-PCR (( i ) 1: Wild type cattle, 2: cDNA from tg cattle, 3: Negative control). After Dre recombinase transfection, GFP excision was confirmed by genomic DNA PCR (( j ) 1: Molecular marker, 2: Before transfection, 3: After transfection, 4: Negative control). Gel image was cropped and original image was seen in .
Single Guide Rna For Gfp With U6 Promoter (Toolgen), supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/cas9+protein/pmc04914850-239-12-26
Average 90 stars, based on 1 article reviews
single guide rna for gfp with u6 promoter (toolgen) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH crispr/cas9 single guide sequences
( a ) After 45 days of embryo transfer, pregnancy was confirmed by ultrasonography. ( b ) The calf was delivered without assistant. ( c ) When ultraviolet light was exposed to nose of tg cattle, GFP expression was strongly observed. And the tg cattle grew up to 12 months old without any healthy issue ( d ). To determine GFP or RFP expression in a piece of tissue or primary skin cells via recombination, the tissue and cells were cultured <t>and</t> <t>transfected</t> with Dre recombinase mRNA by nucleofection (( e ) a piece of tissue from tg cattle-brightness, ( e` ) before Dre recombinase transfection (GFP), ( e`` ) after Dre recombinase transfection (RFP)). The primary skin cells from the tg cattle were isolated, cultured and transfected with Dre recombinase mRNA. Before transfection, only GFP expression was observed, RFP expression were observed via GFP gene excision by recombination (( f – f`` ) before transfection brightness, fluorescence, and merged, respectively; ( g – g`` ) after transfection brightness, fluorescence, and merged, respectively). The transgene integration and recombination were confirmed by genomic DNA PCR (( h ) 1: Molecular maker, 2: Wild type cattle, 3: Blood from tg cattle, 4: Positive control <t>(DNAs),</t> 5: Negative control) and RT-PCR (( i ) 1: Wild type cattle, 2: cDNA from tg cattle, 3: Negative control). After Dre recombinase transfection, GFP excision was confirmed by genomic DNA PCR (( j ) 1: Molecular marker, 2: Before transfection, 3: After transfection, 4: Negative control). Gel image was cropped and original image was seen in .
Crispr/Cas9 Single Guide Sequences, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/lentiviral+vectors/pmc08245960-167-1-19
Average 90 stars, based on 1 article reviews
crispr/cas9 single guide sequences - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

95
Addgene inc single guide rna target sequence gatgtaattaccacatacga
( a ) After 45 days of embryo transfer, pregnancy was confirmed by ultrasonography. ( b ) The calf was delivered without assistant. ( c ) When ultraviolet light was exposed to nose of tg cattle, GFP expression was strongly observed. And the tg cattle grew up to 12 months old without any healthy issue ( d ). To determine GFP or RFP expression in a piece of tissue or primary skin cells via recombination, the tissue and cells were cultured <t>and</t> <t>transfected</t> with Dre recombinase mRNA by nucleofection (( e ) a piece of tissue from tg cattle-brightness, ( e` ) before Dre recombinase transfection (GFP), ( e`` ) after Dre recombinase transfection (RFP)). The primary skin cells from the tg cattle were isolated, cultured and transfected with Dre recombinase mRNA. Before transfection, only GFP expression was observed, RFP expression were observed via GFP gene excision by recombination (( f – f`` ) before transfection brightness, fluorescence, and merged, respectively; ( g – g`` ) after transfection brightness, fluorescence, and merged, respectively). The transgene integration and recombination were confirmed by genomic DNA PCR (( h ) 1: Molecular maker, 2: Wild type cattle, 3: Blood from tg cattle, 4: Positive control <t>(DNAs),</t> 5: Negative control) and RT-PCR (( i ) 1: Wild type cattle, 2: cDNA from tg cattle, 3: Negative control). After Dre recombinase transfection, GFP excision was confirmed by genomic DNA PCR (( j ) 1: Molecular marker, 2: Before transfection, 3: After transfection, 4: Negative control). Gel image was cropped and original image was seen in .
Single Guide Rna Target Sequence Gatgtaattaccacatacga, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pmc07443509-438-1-10
Average 95 stars, based on 1 article reviews
single guide rna target sequence gatgtaattaccacatacga - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

96
Addgene inc crispr cas9 single guide rnas sgrnas
( a ) After 45 days of embryo transfer, pregnancy was confirmed by ultrasonography. ( b ) The calf was delivered without assistant. ( c ) When ultraviolet light was exposed to nose of tg cattle, GFP expression was strongly observed. And the tg cattle grew up to 12 months old without any healthy issue ( d ). To determine GFP or RFP expression in a piece of tissue or primary skin cells via recombination, the tissue and cells were cultured <t>and</t> <t>transfected</t> with Dre recombinase mRNA by nucleofection (( e ) a piece of tissue from tg cattle-brightness, ( e` ) before Dre recombinase transfection (GFP), ( e`` ) after Dre recombinase transfection (RFP)). The primary skin cells from the tg cattle were isolated, cultured and transfected with Dre recombinase mRNA. Before transfection, only GFP expression was observed, RFP expression were observed via GFP gene excision by recombination (( f – f`` ) before transfection brightness, fluorescence, and merged, respectively; ( g – g`` ) after transfection brightness, fluorescence, and merged, respectively). The transgene integration and recombination were confirmed by genomic DNA PCR (( h ) 1: Molecular maker, 2: Wild type cattle, 3: Blood from tg cattle, 4: Positive control <t>(DNAs),</t> 5: Negative control) and RT-PCR (( i ) 1: Wild type cattle, 2: cDNA from tg cattle, 3: Negative control). After Dre recombinase transfection, GFP excision was confirmed by genomic DNA PCR (( j ) 1: Molecular marker, 2: Before transfection, 3: After transfection, 4: Negative control). Gel image was cropped and original image was seen in .
Crispr Cas9 Single Guide Rnas Sgrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/CRISPR-SP-Cas9+reporter+(Plasmid+%2362733)/pmc09512670__mmc2-640-1-28
Average 96 stars, based on 1 article reviews
crispr cas9 single guide rnas sgrnas - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

91
Addgene inc cas9 plasmids pss8
(A-D) RIS-specific knockdown of let-23 reveals a role for EGFR in RIS following cellular stress, in addition to the known role of EGFR in ALA. The heat shock (37°C) is indicated in orange. N indicates number of worms; three biological replicates were performed for each genotype. (A) is the same data as in . (B-C) behavior of the parental strains following a heat shock. (B) The conditional allele of let-23 , FRT::let-23::FRT::GFP , was created using <t>CRISPR/Cas9.</t> (C) The recombinase (FLPase) was expressed in GABAergic neurons, unc-47p::FLP D5 , which include RIS, but no expression was detectable in ALA with this promoter (data not shown). (D) Worms with a conditional knockdown of let-23 in RIS, unc-47p::FLP D5; FRT::let-23::FRT::GFP, displayed reduced quiescence. (E-F) Quantification of locomotion quiescence during and after the heat shock in the conditional strain and in the parental controls. *** denotes statistical significance with p < 0.001, Wilcoxon signed-rank test.
Cas9 Plasmids Pss8, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/pSS8+(Plasmid+%23134473)/bio_rxiv__656512-264-41-58
Average 91 stars, based on 1 article reviews
cas9 plasmids pss8 - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology cd22 crispr cas9 ko plasmid
(A-D) RIS-specific knockdown of let-23 reveals a role for EGFR in RIS following cellular stress, in addition to the known role of EGFR in ALA. The heat shock (37°C) is indicated in orange. N indicates number of worms; three biological replicates were performed for each genotype. (A) is the same data as in . (B-C) behavior of the parental strains following a heat shock. (B) The conditional allele of let-23 , FRT::let-23::FRT::GFP , was created using <t>CRISPR/Cas9.</t> (C) The recombinase (FLPase) was expressed in GABAergic neurons, unc-47p::FLP D5 , which include RIS, but no expression was detectable in ALA with this promoter (data not shown). (D) Worms with a conditional knockdown of let-23 in RIS, unc-47p::FLP D5; FRT::let-23::FRT::GFP, displayed reduced quiescence. (E-F) Quantification of locomotion quiescence during and after the heat shock in the conditional strain and in the parental controls. *** denotes statistical significance with p < 0.001, Wilcoxon signed-rank test.
Cd22 Crispr Cas9 Ko Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/CAS+CRISPR%2FCas9+KO+Plasmid/pmc09780083-152-0-17
Average 93 stars, based on 1 article reviews
cd22 crispr cas9 ko plasmid - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

92
Santa Cruz Biotechnology single guide rnas sgrna
(A-D) RIS-specific knockdown of let-23 reveals a role for EGFR in RIS following cellular stress, in addition to the known role of EGFR in ALA. The heat shock (37°C) is indicated in orange. N indicates number of worms; three biological replicates were performed for each genotype. (A) is the same data as in . (B-C) behavior of the parental strains following a heat shock. (B) The conditional allele of let-23 , FRT::let-23::FRT::GFP , was created using <t>CRISPR/Cas9.</t> (C) The recombinase (FLPase) was expressed in GABAergic neurons, unc-47p::FLP D5 , which include RIS, but no expression was detectable in ALA with this promoter (data not shown). (D) Worms with a conditional knockdown of let-23 in RIS, unc-47p::FLP D5; FRT::let-23::FRT::GFP, displayed reduced quiescence. (E-F) Quantification of locomotion quiescence during and after the heat shock in the conditional strain and in the parental controls. *** denotes statistical significance with p < 0.001, Wilcoxon signed-rank test.
Single Guide Rnas Sgrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/GAL3ST1+CRISPR%2FCas9+KO+Plasmid/pm39000386-328-16-24
Average 92 stars, based on 1 article reviews
single guide rnas sgrna - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

93
Addgene inc guide rna sgrna plv hip cas9 bsd
(A-D) RIS-specific knockdown of let-23 reveals a role for EGFR in RIS following cellular stress, in addition to the known role of EGFR in ALA. The heat shock (37°C) is indicated in orange. N indicates number of worms; three biological replicates were performed for each genotype. (A) is the same data as in . (B-C) behavior of the parental strains following a heat shock. (B) The conditional allele of let-23 , FRT::let-23::FRT::GFP , was created using <t>CRISPR/Cas9.</t> (C) The recombinase (FLPase) was expressed in GABAergic neurons, unc-47p::FLP D5 , which include RIS, but no expression was detectable in ALA with this promoter (data not shown). (D) Worms with a conditional knockdown of let-23 in RIS, unc-47p::FLP D5; FRT::let-23::FRT::GFP, displayed reduced quiescence. (E-F) Quantification of locomotion quiescence during and after the heat shock in the conditional strain and in the parental controls. *** denotes statistical significance with p < 0.001, Wilcoxon signed-rank test.
Guide Rna Sgrna Plv Hip Cas9 Bsd, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/T4+Lysozyme+S44E+WT*+(Plasmid+%2318323)/pmc09586874-290-22-28
Average 93 stars, based on 1 article reviews
guide rna sgrna plv hip cas9 bsd - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

96
Addgene inc cas9 single guide rna sgrna expression vector
(A-D) RIS-specific knockdown of let-23 reveals a role for EGFR in RIS following cellular stress, in addition to the known role of EGFR in ALA. The heat shock (37°C) is indicated in orange. N indicates number of worms; three biological replicates were performed for each genotype. (A) is the same data as in . (B-C) behavior of the parental strains following a heat shock. (B) The conditional allele of let-23 , FRT::let-23::FRT::GFP , was created using <t>CRISPR/Cas9.</t> (C) The recombinase (FLPase) was expressed in GABAergic neurons, unc-47p::FLP D5 , which include RIS, but no expression was detectable in ALA with this promoter (data not shown). (D) Worms with a conditional knockdown of let-23 in RIS, unc-47p::FLP D5; FRT::let-23::FRT::GFP, displayed reduced quiescence. (E-F) Quantification of locomotion quiescence during and after the heat shock in the conditional strain and in the parental controls. *** denotes statistical significance with p < 0.001, Wilcoxon signed-rank test.
Cas9 Single Guide Rna Sgrna Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+encoding+an+single-guide+rna+targeting+hla-e+and+cas9+with+puromycin+resistance/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pmc07381364-120-18-25
Average 96 stars, based on 1 article reviews
cas9 single guide rna sgrna expression vector - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

Image Search Results


( a ) After 45 days of embryo transfer, pregnancy was confirmed by ultrasonography. ( b ) The calf was delivered without assistant. ( c ) When ultraviolet light was exposed to nose of tg cattle, GFP expression was strongly observed. And the tg cattle grew up to 12 months old without any healthy issue ( d ). To determine GFP or RFP expression in a piece of tissue or primary skin cells via recombination, the tissue and cells were cultured and transfected with Dre recombinase mRNA by nucleofection (( e ) a piece of tissue from tg cattle-brightness, ( e` ) before Dre recombinase transfection (GFP), ( e`` ) after Dre recombinase transfection (RFP)). The primary skin cells from the tg cattle were isolated, cultured and transfected with Dre recombinase mRNA. Before transfection, only GFP expression was observed, RFP expression were observed via GFP gene excision by recombination (( f – f`` ) before transfection brightness, fluorescence, and merged, respectively; ( g – g`` ) after transfection brightness, fluorescence, and merged, respectively). The transgene integration and recombination were confirmed by genomic DNA PCR (( h ) 1: Molecular maker, 2: Wild type cattle, 3: Blood from tg cattle, 4: Positive control (DNAs), 5: Negative control) and RT-PCR (( i ) 1: Wild type cattle, 2: cDNA from tg cattle, 3: Negative control). After Dre recombinase transfection, GFP excision was confirmed by genomic DNA PCR (( j ) 1: Molecular marker, 2: Before transfection, 3: After transfection, 4: Negative control). Gel image was cropped and original image was seen in .

Journal: Scientific Reports

Article Title: Efficient generation of transgenic cattle using the DNA transposon and their analysis by next-generation sequencing

doi: 10.1038/srep27185

Figure Lengend Snippet: ( a ) After 45 days of embryo transfer, pregnancy was confirmed by ultrasonography. ( b ) The calf was delivered without assistant. ( c ) When ultraviolet light was exposed to nose of tg cattle, GFP expression was strongly observed. And the tg cattle grew up to 12 months old without any healthy issue ( d ). To determine GFP or RFP expression in a piece of tissue or primary skin cells via recombination, the tissue and cells were cultured and transfected with Dre recombinase mRNA by nucleofection (( e ) a piece of tissue from tg cattle-brightness, ( e` ) before Dre recombinase transfection (GFP), ( e`` ) after Dre recombinase transfection (RFP)). The primary skin cells from the tg cattle were isolated, cultured and transfected with Dre recombinase mRNA. Before transfection, only GFP expression was observed, RFP expression were observed via GFP gene excision by recombination (( f – f`` ) before transfection brightness, fluorescence, and merged, respectively; ( g – g`` ) after transfection brightness, fluorescence, and merged, respectively). The transgene integration and recombination were confirmed by genomic DNA PCR (( h ) 1: Molecular maker, 2: Wild type cattle, 3: Blood from tg cattle, 4: Positive control (DNAs), 5: Negative control) and RT-PCR (( i ) 1: Wild type cattle, 2: cDNA from tg cattle, 3: Negative control). After Dre recombinase transfection, GFP excision was confirmed by genomic DNA PCR (( j ) 1: Molecular marker, 2: Before transfection, 3: After transfection, 4: Negative control). Gel image was cropped and original image was seen in .

Article Snippet: As briefly, primary cells from a transgenic cattle (SNU-PB-2) were transfected with plasmid DNAs (Cas9 with CMV promoter, single guide RNA for GFP with U6 promoter (Toolgen, Seoul, Republic of Korea), donor DNAs for Knock-In; ) using Nucleofactor technology (Neon ® , Invitrogen; program #16).

Techniques: Expressing, Cell Culture, Transfection, Isolation, Fluorescence, Positive Control, Negative Control, Reverse Transcription Polymerase Chain Reaction, Marker

( a ) After 45 days of embryo transfer, pregnancy was confirmed by ultrasonography. ( b ) The calf was delivered without any assistance and grew up to 2 months. Analyzing the calf without ultraviolet light, GFP expression was observed in the eyes ( c ) and nose ( d ). The tg cattle have been grown to 5 months old without any health issue ( e ). When ultraviolet light was exposed to the head, GFP expression was strongly observed ( f ). To know GFP in skin cells, the primary skin cells from the tg cattle were isolated and cultured. In over 99% of cells, GFP expression were observed (( g ) brightness; ( g` ) fluorescence). The transgene integration was confirmed by genomic DNA PCR (( h ) 1: Molecular maker, 2: Wild type cattle, 3: Blood from tg cattle, 4: Positive control (DNAs), 5: Negative control) and RT-PCR using primary cells (( i ) 1: cDNA from Wild type cattle, 2: cDNA from tg cattle, 3: Negative control). Gel image was cropped and original image was seen in .

Journal: Scientific Reports

Article Title: Efficient generation of transgenic cattle using the DNA transposon and their analysis by next-generation sequencing

doi: 10.1038/srep27185

Figure Lengend Snippet: ( a ) After 45 days of embryo transfer, pregnancy was confirmed by ultrasonography. ( b ) The calf was delivered without any assistance and grew up to 2 months. Analyzing the calf without ultraviolet light, GFP expression was observed in the eyes ( c ) and nose ( d ). The tg cattle have been grown to 5 months old without any health issue ( e ). When ultraviolet light was exposed to the head, GFP expression was strongly observed ( f ). To know GFP in skin cells, the primary skin cells from the tg cattle were isolated and cultured. In over 99% of cells, GFP expression were observed (( g ) brightness; ( g` ) fluorescence). The transgene integration was confirmed by genomic DNA PCR (( h ) 1: Molecular maker, 2: Wild type cattle, 3: Blood from tg cattle, 4: Positive control (DNAs), 5: Negative control) and RT-PCR using primary cells (( i ) 1: cDNA from Wild type cattle, 2: cDNA from tg cattle, 3: Negative control). Gel image was cropped and original image was seen in .

Article Snippet: As briefly, primary cells from a transgenic cattle (SNU-PB-2) were transfected with plasmid DNAs (Cas9 with CMV promoter, single guide RNA for GFP with U6 promoter (Toolgen, Seoul, Republic of Korea), donor DNAs for Knock-In; ) using Nucleofactor technology (Neon ® , Invitrogen; program #16).

Techniques: Expressing, Isolation, Cell Culture, Fluorescence, Positive Control, Negative Control, Reverse Transcription Polymerase Chain Reaction

(A-D) RIS-specific knockdown of let-23 reveals a role for EGFR in RIS following cellular stress, in addition to the known role of EGFR in ALA. The heat shock (37°C) is indicated in orange. N indicates number of worms; three biological replicates were performed for each genotype. (A) is the same data as in . (B-C) behavior of the parental strains following a heat shock. (B) The conditional allele of let-23 , FRT::let-23::FRT::GFP , was created using CRISPR/Cas9. (C) The recombinase (FLPase) was expressed in GABAergic neurons, unc-47p::FLP D5 , which include RIS, but no expression was detectable in ALA with this promoter (data not shown). (D) Worms with a conditional knockdown of let-23 in RIS, unc-47p::FLP D5; FRT::let-23::FRT::GFP, displayed reduced quiescence. (E-F) Quantification of locomotion quiescence during and after the heat shock in the conditional strain and in the parental controls. *** denotes statistical significance with p < 0.001, Wilcoxon signed-rank test.

Journal: bioRxiv

Article Title: Epidermal Growth Factor signaling acts directly and through a sedation neuron to depolarizes a sleep-active neuron following cellular stress

doi: 10.1101/656512

Figure Lengend Snippet: (A-D) RIS-specific knockdown of let-23 reveals a role for EGFR in RIS following cellular stress, in addition to the known role of EGFR in ALA. The heat shock (37°C) is indicated in orange. N indicates number of worms; three biological replicates were performed for each genotype. (A) is the same data as in . (B-C) behavior of the parental strains following a heat shock. (B) The conditional allele of let-23 , FRT::let-23::FRT::GFP , was created using CRISPR/Cas9. (C) The recombinase (FLPase) was expressed in GABAergic neurons, unc-47p::FLP D5 , which include RIS, but no expression was detectable in ALA with this promoter (data not shown). (D) Worms with a conditional knockdown of let-23 in RIS, unc-47p::FLP D5; FRT::let-23::FRT::GFP, displayed reduced quiescence. (E-F) Quantification of locomotion quiescence during and after the heat shock in the conditional strain and in the parental controls. *** denotes statistical significance with p < 0.001, Wilcoxon signed-rank test.

Article Snippet: : To insert the second frt site 2 kb upstream of frt::gfp and 5’to the protein kinase domain in the let-23 locus, the repair oligonucleotide OSS99 was injected into zh130 at a concentration of 500nM, the two single guide with integrated CAS9 plasmids pSS8 and pSS9 at a concentration of 25 ng/µl each with the Co-injection marker pCFJ90 (Addgene 19327) at 2.5 ng/µl.

Techniques: CRISPR, Expressing